Institutional Repository

U n i v e r s i t y of P e r a d e n i y a

The Institutional Repository of the University of Peradeniya is the University's digital gateway to scholarly knowledge and research excellence. Established as the next phase of the Digital Library initiative launched by the University Library in 2011, it preserves, showcases, and provides open access to the intellectual output of the University community.

Through a rich collection of research articles, conference proceedings, theses, dissertations, and other scholarly works, the repository enhances the visibility, accessibility, and long-term preservation of knowledge, extending the global reach and impact of the University of Peradeniya’s academic and research contributions.

Photo by @ITD,Main Library

Communities in DSpace

Select a community to browse its collections.

Now showing 1 - 5 of 5

Recent Submissions

Molecular detection of lumpy skin disease virus in Sri Lanka-first report
(University of Peradeniya, 2021-11-11) Rathnayake, R.M.I.M.; Kalupahana, A.W.
Lumpy skin disease (LSD) is a notifiable disease caused by lumpy skin disease virus (LSDV) in the Genus Capripoxvirus of the Family Poxviridae. Although cattle are the main natural host, it is observed in water buffalo and Arabian oryx. LSDV is transmitted by hematophagous insects. Initially, LSDV causes fever with enlarged superficial lymph nodes. Within 7-9 days, characteristic multiple, circumscribed to coalescing, firm nodules appear mainly on the head, neck, udder, scrotum, vulva, and perineum. A necrotic plug (―sit-fast‖) develops by two weeks. Nodules may also develop in mucous membranes and internal organs. LSD cause reduced milk and meat production, temporary infertility, reduced hide quality and trade losses due to movement restrictions. The disease severely affects young animals and cows in peak lactation. LSD was endemic to Africa, that gradually spread to the Middle East and Eastern Europe, before spreading to Asia recently. LSD was exotic to Sri Lanka until early 2020. However, in October 2020, cattle manifesting clinical signs suggestive of LSD were reported from North and Eastern provinces of the country. More recently, animals showing similar signs were reported from Anuradhapura, Polonnaruwa, Puttalam, Kurunegala, Galle, Colombo and Rathnapura districts. Skin nodules were collected from affected cattle in Udahamulla veterinary range. Total DNA was extracted using Qiagen DNeasy blood and tissue kit according to manufacturer‘s protocol. A conventional PCR was performed on 5 samples to detect the coding region of viral attachment protein of LSDV using modified OIE recommended primers, LSDF 5‘TCCGAGCTCTTTTCTTACTAT3‘ and LSDR 5‘TATGGTACCTAAATTATATACGTAAATAAC3‘. Based on the history, clinical signs, and the PCR results of 192 bp band, it was confirmed that the cattle were affected with LSDV. This study is the first report of local laboratory confirmation of the presence of LSDV within Sri Lanka. Further molecular characterization of the aetiological agent is ongoing.
A health risk assessment and evaluation of sugar levels in soft drinks
(University of Peradeniya, Sri Lanka, 2021-11-11) Ruhunuge, I.J.A.; Wijeratne, A.W.; Ruhunuge, R.D.R.
There is a rising tendency among early adults of consuming natural drinks over soft drinks. Because of some practical limitations, still they consume unhealthy instant drinks which contain excessive added sugar. Yet, the upper and lower exposure limit of added /sugar of soft drinks has not been scientifically assessed in comparison to the accepted limits of the American Heart Association (AHA). Therefore, this study was conducted with a social survey and laboratory analysis to evaluate sugar levels of soft drinks to ascertain health risks. Seven soft drink brands were selected at the local market and total and reducing sugar contents were evaluated by the Lane-Eynon method. The survey results showed that the exposure level for males was 0.8 to 7 g/day, whereas the same for females was 0.8 to 12 g/day. In this population about 11% of women and 4% of men are at the risk of lower exposure limit while 52% of women and 23% of men are at risk of upper exposure limit where the recommended maximum daily exposure to added sugar is 2.93 g/day for females and 4.23 g/day for males. This exposure level of the selected population ranged from 0.8 to 12 g/day. All samples considered in this study have the potential for enamel dissolution since their pH values considerably lower the critical level of 5.5. The outcomes of the study indicated that young adults must be watchful towards excessive added sugar from instant drink. Furthermore, as a suggestion, it must be required to promote natural drinks to ensure a healthy generation in the future.
Association of patterns of food intake and physical activity with weight-for- height measures among preschoolers in Galigamuwa Division
(University of Peradeniya, Sri Lanka, 2021-11-11) Chandrasiri, W.S.C.; Marambe, K.N.
Childhood malnutrition is a major health problem in the developing countries in South Asia. This study attempted to determine the associations of patterns of food intake and physical activity with weight-for-height measurements among preschoolers in a rural area in Sri Lanka. This is a preschool-based cross-sectional study involving 250 preschoolers aged three to five years from Galigamuwa Divisional Secretariat area, Sri Lanka. Anthropometric data including height and weight were measured. Data on dietary pattern, duration of watching television and physical activity were obtained through a tailor made, validated, self-administered questionnaire filled by parent or guardian. Chi square test was performed to determine associations. The prevalence of overweight/obesity, moderate acute malnutrition and severe acute malnutrition was 3%, 15% and 8% respectively. Daily intake of breakfast was observed only in 59%. Most of the preschoolers consumed three meals a day (57%). The findings revealed that breakfast consumption (p=0.000), number of meals per day (p=0.000) were significantly associated with weight-for-height. Acute malnutrition showed a positive association with skipping breakfast and negative association with number of meals per day. Overall, 60% of the preschoolers reported to be engaged in outdoor playing activities >3 hour/day while 46% reported watching television >1 hour/day. However, all obese/overweight preschoolers reported to have spent >1 hour/day, watching television. The results revealed nearly 23% of the preschoolers were malnourished in the selected rural population. Skipping breakfast and reduced number of meals were predictors of acute malnutrition while time spent on watching television >1 hour/day and physical activity <3 hours/day were predictors of overweight/ obesity among preschoolers. It is emphasized that the parents and care givers be made aware of their role to prevent overweight/obesity and malnutrition by restricting unhealthy food intake patterns and encouraging physical activities. Further research using a large sample is required to confirm these findings.
Teaching and learning approaches in current secondary school food literacy curricula
(University of Peradeniya, Sri Lanka, 2021-11-11) Dimalini, S.; Perera, T.; Nanayakkara, J.; Silva, K.D.R.R.
Food literacy is a new and emerging concept that helps understand the impact of food choices on individual well-being. The purpose of this qualitative study was to explore the importance of food literacy education, teaching and learning approaches used in the classroom, and the challenges and barriers faced by teachers in teaching the food literacy curriculum in secondary schools. The teachers who teach the subjects Health and Physical Education, Agriculture and Food Technology, Home Economics, Practical and Technical Skills, and Science in the Northern Province were selected using the maximum variation sampling technique. A total of 96 teachers participated in 11 focus group discussions. The discussions were analyzed using the template analysis technique using the NVivo 12 qualitative data analysis software and six major themes related to teaching and learning approaches were identified. All teachers approved of the importance of food literacy. Most teachers indicated that they use textbooks, blackboard and school gardens as the main teaching tools. Practical sessions, group discussions, and field visits were identified as the main methods of teaching. Most teachers perceived textbooks and practical sessions as the most effective teaching tools and methods. Student assignments and school term examinations were considered as the major evaluation methods. Though the majority of teachers were generally positive and understood the importance of food literacy education, they face certain barriers and challenges such as lack of support from parents and school administration and shortages in resources including funds, tools, equipment, and teacher training in food and nutrition. Hence, more resources and training to facilitate the delivery of food literacy education is needed. The findings of this study help understand the strengths, drawbacks, and potential areas for improvements in secondary school food literacy education in Sri Lanka.
Nutritional and functional properties of defatted desiccated coconut flour of different coconut varieties
(University of Peradeniya, Sri Lanka, 2021-11-11) Pathirana, H.P.D.T.H.; Lakdushighe, W.M.K.; Yalegama, L.L.W.C.; Chandrapeli, C.A.T.D.; Waidyarathne, K.P.; Marikkar, J.M.N.
Defatted desiccated coconut flour (DCF) is a by-product of dry processing of virgin coconut oil (VCO). Processing of VCO is limited to commercially available coconut varieties but the varietal effect is not considered. Therefore, aim of this research was to evaluate the nutritional and functional properties of DCF extracted from four types of coconut varieties, namely Tall×Tall (TT), Gon Thambili (GT), Ran Thambili (RT) and San Ramon (SR). Whole wheat flour (WWF) was used as the control. Fifty fully matured coconuts from each variety were collected from Bandirippuwa Estate of Coconut Research Institute, Lunuwila, Sri Lanka to produce VCO and by-product of residue was collected and converted into flour. The functional and nutritional properties of each flour were evaluated using standard methods. Experiment was arranged as a complete randomized design (CRD) with three replicates and each parameter was analyzed using one-way ANOVA. Analysis confirmed that there was no significant (p>0.05) varietal effect for the amount recovery of DCF (15.33 ± 0.41%). About 23.16% of DCF has less than 250 μm size particles and very low moisture contents ranging from 2 - 4% without showing significant difference between varieties. The variety GT showed significantly higher swelling capacity (49.00±0.00 ml) and wettability (27.46±0.00 s) while showing significantly lower bulk density (0.48±0.00 g/ml) and tapped density (0.56±0.00 g/ml). GT and TT varietal flour has lower hygroscopicity (11.65%) while retaining lower fat (13.74 ±1.84%) content in GT flour. Significantly high protein (22.07±0.63 %) and ash (6.81±0.67%) could be observed in both SR and TT. Four types of DCF can be used as a fiber supplement (between 16.72±0.94% to 18.70±0.17%) whereas WWF is rich in carbohydrate (69.84±0.30%). GT flour has higher functional properties while SR and TT showed higher protein and fiber. Therefore, DCF can be used as a nutritive and functional supplement.